英語 [English] / 日本語 [Japanese]

MolliBase: Details of Record

Back


TNS:F:13488

Detail

Catalog number13488
Scientific nameMollisia sp.
GenusMollisia
Specific epithet
Infraspecific epithet
Taxon rank
Scientific name authorship
CountryJapan
LocalityShiratani Unsuikyo, Yakushima Isl., Kagoshima
Habitaton unidentified wood
Minimum elevation in meters625.0
Decimal latitude30.37886
Decimal longitude130.57416
Year2005
Month10
Day18
Isolate IDFC-1250
Other isolate ID
Isolate statussingle
DNA sample IDED20116
NoteMLZ+ with KOH pretreatment; KOH reaction negative.

Sequence

Sequence ID4566
Region name
INSD Accession No. (DDBJ/NCBI/EMBL)
BOLD Accession No.
Sequence
>T_13488S4566
TCCTTCCGTTAGGGGGAACCTGCGGAAGGATCATTACAGTGTTTTCTGCGCCCTGAAAAGGGTCAGAACT
CCCACCCTTGAGTACTTATAGTTTGTTGCTTTGGCGGGCCACGAGGCCTAGCCGCGCCCCGGCTTCGGCG
GGGGAGTGCCCGCCAGAGGACCCCAAACCCTGAATGTTAGTGTCGTCTGAGTACTATACAATAGTTAAAA
CTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAAT
TGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCT
GTTCGAGCGTCATAATAGCCAATCCAGCTTGCTGGGTCTTGGGCGCCGCCGTCGGGCGGGCCTCAAACGT
AGTGGCGGTACGGCCAGACTCTAAGCGTAGTAAATCTTCTCGCTATAGCGTCCCGGGCGGCACTTGCCAA
CAACCCCCAATTTTATCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAA
GCGGAGGGGAA

Image

Caption
Image Tnsf 13488x2 ph1253 dm0025 640
Image Tnsf13488f

Map


Back