英語 [English] / 日本語 [Japanese]

MolliBase: Details of Record

Back


TNS:F:13509

Detail

Catalog number13509
Scientific nameMollisia sp.
GenusMollisia
Specific epithet
Infraspecific epithet
Taxon rank
Scientific name authorship
CountryJapan
LocalityShiratani Unsuikyo, Yakushima Isl., Kagoshima
Habitaton Elaeocarpus japonicus wood
Minimum elevation in meters625.0
Decimal latitude30.37886
Decimal longitude130.57416
Year2005
Month10
Day19
Isolate IDFC-1269
Other isolate ID
Isolate statussingle
DNA sample IDED20117
NoteMLZ+ with KOH pretreatment; KOH reaction negative.

Sequence

Sequence ID4569
Region name
INSD Accession No. (DDBJ/NCBI/EMBL)
BOLD Accession No.
Sequence
>T_13509S4569
TCCTTCCGTAAGGGTAACCTGCGGAAGGATCATTATATATATAAAAGGATACCTTTTGGTATACCTCCCT
ATCCCGTGTCTACTTATACTCTTGTTGCTTTGGCAGGCCGTGGTCTTGACCCTGTGGGCTTCAGCTTGCA
TGTGCCTGCCAGAGGACCAAACTCTGAATTTTAGTGATGTCTGAGTACTATCTAATAGTTAAAACTTTCA
ACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGA
ATTCAGTGAATCATCGAATCTTTGAACGCACATTGCACCCGGTGGTATTCCGCCGGGTATGCCTGTTCGA
GCGTCTCTATCAACCGTCATGCTTCGGCGTGGAACTGGGGATTGCGGTCTTCTGCAGCCCTGAATCTCTT
AAGCGATACCAGTTGGTGCTAAGCGTAGTACATACCCCGCTACAGGACTTAGCTGGTCTTCGGCTGTAAA
TGGTGCAAGCCCATACTTAAGGTTGACCTCGGATCAAGTAGGGATACCCGCTGAACTTAAGCATATCAAT
AA

Image

Caption
Image Tnsf 13509x2 ph1259 dm0011 640
Image Tnsf 13509x2 ph1260 dm0012 640
Image Tnsf 13509x2 ph1261 dm0013 640
Image Tnsf13509f

Map


Back