英語 [English] / 日本語 [Japanese]

MolliBase: Details of Record

Back


TNS:F:13512

Detail

Catalog number13512
Scientific nameMollisia sp.
GenusMollisia
Specific epithet
Infraspecific epithet
Taxon rank
Scientific name authorship
CountryJapan
LocalityUpstream of Tomari-gawa River, Yakushima Isl., Kagoshima Pref.
Habitaton unidentified wood
Minimum elevation in meters480.0
Decimal latitude30.25533
Decimal longitude130.49019
Year2005
Month10
Day20
Isolate IDFC-1273
Other isolate ID
Isolate statussingle
DNA sample IDED20118
NoteMLZ+ with KOH pretreatment; KOH reaction negative.

Sequence

Sequence ID4570
Region name
INSD Accession No. (DDBJ/NCBI/EMBL)
BOLD Accession No.
Sequence
>T_13512S4570
TCCTTCCGTAGGGGGAACCTGCGGAAGGATCATTAATAAAAGGATACCCTCGGGTATACCCCATCCGTGC
CTATATACTCTTGTTGCTTTGGCAGGCCGTGGTCTCCCACTGCGGGCTCTGCCTGCATGTGCCTGCCAGA
GGACCAAACTCTGAATCTTAGTGATGTCTGAGTACTATATAATAGTTAAAACTTTCAACAACGGATCTCT
TGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCA
TCGAATCTTTGAACGCACATTGCACCCGGTGGTATTCCGCCGGGTATGCCTGTTCGAGCGTCTTTAGGAC
AACACCAATAGCAGGCTTAGGCTTGATTTTGGGGTTGCGGCGTCAAGCTGCAGCCCTGAAGACCACGGGC
GGTTCCGGTAGGTTCTATGCGTAGTAATTTCTCCTCGCTACAGAGCTTTGCTGGAGCATTGGTACTAAGT
CCATTTATGGCCACTCCGAGCCCCTAACACCCAACTTCAAGTTGACCTCGGATCAAGTAGGGATACCCGC
TGAACTTAAGCATATCAATAAGC

Image

Caption
Image Tnsf 13512x2 ph1256 dm0004 640
Image Tnsf13512f

Map


Back