英語 [English] / 日本語 [Japanese]

MolliBase: Details of Record

Back


TNS:F:13522

Detail

Catalog number13522
Scientific nameMollisia sp.
GenusMollisia
Specific epithet
Infraspecific epithet
Taxon rank
Scientific name authorship
CountryJapan
LocalityYakusugi Land, Yakushima Isl., Kagoshima Pref.
Habitaton unidentified branch
Minimum elevation in meters965.0
Decimal latitude30.30988
Decimal longitude130.57991
Year2005
Month10
Day22
Isolate IDFC-1279
Other isolate ID
Isolate statussingle
DNA sample IDED20119
NoteMLZ+ with KOH pretreatment; KOH reaction negative.

Sequence

Sequence ID4573
Region name
INSD Accession No. (DDBJ/NCBI/EMBL)
BOLD Accession No.
Sequence
>T_13522S4573
TCCTTCCGTAAGGGGGAACCTGCGGAAGGATCATTACAGTGTTTTCTGCCCTGCGAAGGGTTTGAACTCC
ACCCTTGCCTATTACAGTTTGTTGCTTCGGTGGGCCACGAGGCCTAGCCACGCCCCGGCTTCGGCGGGGG
AGTGCCCGCCAGAGGACCCCAAACCCTGAATGTTTAAGTGTCGTCTGAGTACTATACAATAGTTAAAACT
TTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTG
CAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGGGGGGCATGCCTGT
TCGAGCGTCATTACAACCAATCCAGCTCGCTGGGTCTTGGGTACCGCCGGAAGGCGGGCCTCAAATGCAG
TGGCGGGCCGGCCGGGCTCTAAGCGTAGTACAACACCTCGCTATAGGGTCCTGGGCGGCACCTTGCCAGC
AACCCCCAACTCATCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAA

Image

Caption
Image Tnsf 13522x2 ph1256 dm0008 640
Image Tnsf 13522x2 ph1256 dm0011 640
Image Tnsf13522f

Map


Back