英語 [English] / 日本語 [Japanese]

MolliBase: Details of Record

Back


TNS:F:13529

Detail

Catalog number13529
Scientific nameMollisia sp.
GenusMollisia
Specific epithet
Infraspecific epithet
Taxon rank
Scientific name authorship
CountryJapan
LocalityYakusugi Land, Yakushima Isl., Kagoshima Pref.
Habitaton unidentified wood
Minimum elevation in meters965.0
Decimal latitude30.30988
Decimal longitude130.57991
Year2005
Month10
Day22
Isolate IDFC-1282
Other isolate ID
Isolate statussingle
DNA sample IDED20120
NoteMLZ+ with KOH pretreatment; KOH reaction negative.

Sequence

Sequence ID4574
Region name
INSD Accession No. (DDBJ/NCBI/EMBL)
BOLD Accession No.
Sequence
>T_13529S4574
CCTTCCGTAGGGGAACCTGCGGAAGGATCATTAATCAGTGGATCCGGCGGGGACCTCCCCGCCGGGTAGA
CCTCCACCCGTGCCTACCTACTCTTGTTGCTTTGGCGGGCCGTGGCCTCCACTACGGGCTCTGCTCGTAC
GTGCCCGCCAGAGGACCAAACTCTGAATTTTAGTGATGTCTGAGTACTATTTAATAGTTAAAACTTTCAA
CAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAA
TTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTGTGGTATTCCGCAGGGCATGCCTGTTCGAG
CGTCATTTAGACCACTCACGCCTGGCGTGGTATTGGGGCACGCGGTTCTGCGGCCCTCAAAATCAGTGGC
GGTGCCGGTAGGCCCTAAGCGTAGTAAATTTCCTCGCTATAGGGACCTCTCGGTGGCTCGCCAGAACCCC
TAACTTCTTAAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAA

Image

Caption
Image Tnsf 13529x2 ph1256 dm0014 640
Image Tnsf13529f

Map


Back