英語 [English] / 日本語 [Japanese]

MolliBase: Details of Record

Back


TNS:F:13598

Detail

Catalog number13598
Scientific nameMollisia sp.
GenusMollisia
Specific epithet
Infraspecific epithet
Taxon rank
Scientific name authorship
CountryJapan
LocalityFuji 2-gome, Fujiyoshida-shi, Yamanashi Pref.
Habitaton unidentified wood
Minimum elevation in meters1596.0
Decimal latitude35.41686
Decimal longitude138.711
Year2006
Month10
Day14
Isolate IDFC-1468
Other isolate ID
Isolate statussingle
DNA sample IDED20130
NoteMLZ- with KOH pretreatment; KOH reaction negative.

Sequence

Sequence ID4636
Region name
INSD Accession No. (DDBJ/NCBI/EMBL)
BOLD Accession No.
Sequence
>T_13598S4636
ACCTGCGGAAGGATCATTAATCGGTGGATCTGGTACTGGGGGCCAGCGGGAGCGGCCGTGAGCAAAAATC
CCGCCGGATAGACCACACCCGTGTTTACCTACTCTTGTTGCTTTGGCGGGCCGTGGCCTTCCACTACGGG
CGCTGCTCGTACGTGCCCGCCAGAGGACCAAACTCTGAATTATAGTGATGTCTGAGTACTATCTAATAGT
TAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATG
TGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTGTGGTATTCCGCAGGGCA
TGCCTGTTCGAGCGTCATTTAGACCACTCACGCCTGGCGTGGTATTGGGGCACGCGGTTCCGCGGCCCTC
AAAATCAGTGGCGGCGCCGGTAGGCCCTAAGCGTAGTAAATCTCCTCGCTATAGGGTCCTCTCGGTGGCT
CGCCAGAACCCCCAACTTCTCAAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATC
AATA

Image

Caption
Image Tnsf 13598x2 ph1256 dm0020 640
Image Tnsf 13598x2 ph1256 dm0021 640
Image Tnsf13598f

Map


Back