英語 [English] / 日本語 [Japanese]

MolliBase: Details of Record

Back


TNS:F:16808

Detail

Catalog number16808
Scientific nameMollisia sp.
GenusMollisia
Specific epithet
Infraspecific epithet
Taxon rank
Scientific name authorship
CountryJapan
LocalityMt. Shirane, Kusatsu-machi, Agatsuma-gun, Gunnma Pref.
Habitaton unidentied wood
Minimum elevation in meters1020.0
Decimal latitude36.61514
Decimal longitude138.60875
Year2007
Month6
Day8
Isolate IDFC-2328
Other isolate ID
Isolate statussingle
DNA sample IDED20137
NoteMLZ+ with KOH pretreatment; KOH reaction negative.

Sequence

Sequence ID2581
Region name
INSD Accession No. (DDBJ/NCBI/EMBL)
BOLD Accession No.
Sequence
>T_16808S2581
CAGTCCTTCTGTAGCAGAGCTTAACGGAGACCTTGCACCCGAGAGGGGAGAGGCGACTATAAAGAACTCT
TAGCGCAAGTCAGCACCGCTGGCAACACAATCGAATTGCGGGGACGCTTTAAAGCTCACCAGTACCAACC
GCTCTTCCAGGGCGGGGCTAGCCTAGCTAGAGGTCACAACCTGGTGGGATGCCACAATAAGCAATCCGCA
GCGGCCCAGCCGTCCACAGACTAAGTGGTTGTGGGTAGGAGACCCCCCCCTACTTAAGATATAGTCGGGC
CCTGTGACAAGTCATGGGGGTTCTGCGTCCGTAGGTGAACCTGCGGAAGGATCATTACCAATTGGGTGCC
CTCGGGCATACCGAATCCGTGTCTACATACTCTTGTTGCTTTGGCAGGCCGTGGCCTTCCACTGTGGGCC
CTGCCTGCACGTGCCTGCCAGAGAGGACCAAACTCTGAATTTTATTGATGTCTGAGTACTATATAATAGT
CAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATG
TGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTGTGGCATTCCGCAGGGCA
TGCCTGTTCGAGCGTCATTATAGCCACTCAAGCCTAGCTTGGTGTTGGGGTTCGCGGTCCCGCGGCTCCT
AAATTCAGTGGCGGTGCCTGTAGGCTCTGAGCGTAGTAAATCTCCTCGCTATAGAGTCCTATGGGTTCCC
TGCCAAAACCCCCATATTTTATAGATGACCTCGGATCA

Image

Caption
Image Tnsf 16808x2 ph1256 dm0035 640
Image Tnsf16808f

Map


Back