英語 [English] / 日本語 [Japanese]

MolliBase: Details of Record

Back


TNS:F:16828

Detail

Catalog number16828
Scientific nameMollisia sp.
GenusMollisia
Specific epithet
Infraspecific epithet
Taxon rank
Scientific name authorship
CountryJapan
LocalitySugadaira Montane Research Center, University of Tsukuba, Ueda City, Nagano Pref.
Habitaton herb stem
Minimum elevation in meters1269.0
Decimal latitude36.51933
Decimal longitude138.35305
Year2007
Month6
Day10
Isolate IDFC-2344
Other isolate ID
Isolate statussingle
DNA sample IDED13269
NoteMLZ+ with KOH pretreatment; KOH reaction negative.

Sequence

Sequence ID618
Region name
INSD Accession No. (DDBJ/NCBI/EMBL)
BOLD Accession No.
Sequence
>T_16828S618
ACCTGCGGAAGGATCATTACTAGAGCAAAGAACAGACAGCGCCCCATAGGAGCTTGCTCCGTGGCGGGCT
ACCCTACTCGTAGGGTCTAGAGTCGTAGGGCCTCTCGGAGAAGCCCTGTTCTGAACTCCACCCTTGAATA
AATTACCTTTGTTGCTTTGGCAGGCCGCCTAGTGCCAGCGGCTTCGGCTGTTGAGTGCCTGCCAGAGACC
TATAACTCGTATTGTTAATGATGTCTGAGTACTATATAATAGTTAAAACTTTCAACAACGGATCTCTTGG
TTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCG
AATCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTATAACCAC
TCAAGCTCTCGCTTGGTATTGGGGTTCGCGGTTTCGCGGCCCCTAAAATCAGTGGCGGTGCCTGTCGGCT
CTACGCGTAGTAATACTCCTCGCGATTGAGTCCGGTAGGTCTACTTGC

Image

Caption
Image Tnsf 16828x2 ph1256 dm0043 640
Image Tnsf16828f

Map


Back