英語 [English] / 日本語 [Japanese]

MolliBase: Details of Record

Back


TNS:F:17103

Detail

Catalog number17103
Scientific namePyrenopeziza nervicola
GenusPyrenopeziza
Specific epithetnervicola
Infraspecific epithet
Taxon rank
Scientific name authorship
CountryJapan
LocalityKuni-mura, Gunma Pref.
Habitaton Quercus serrata subsp. serrata var. serrata leaf
Minimum elevation in meters1080.0
Decimal latitude36.64889
Decimal longitude138.61539
Year2004
Month5
Day15
Isolate IDFC-1006
Other isolate ID
Isolate statussingle
DNA sample IDED20090
NoteMLZ+ with KOH pretreatment; KOH reaction negative.

Sequence

Sequence ID4522
Region name
INSD Accession No. (DDBJ/NCBI/EMBL)
BOLD Accession No.
Sequence
>T_17103S4522
AACCTGCGGAAGGATCATTATCAAGGTTAAAGGTGACGCCCCGGCGTCAACCGAACCCGTGTCTATCTAC
TCTTGTTGCTTTGGCAGGCCGTGGGAAACCACCGCGGGCCCCGGCCCTCGAGCGCCTGCCAGAGGACCAA
ACTCTGAATTTTAGTGATGTCTGAGTACTATATAATAGTTAAAACTTTCAACAACGGATCTCTTGGTTCT
GGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATC
TTTGAACGCACATTGCGCCCGGTGGTATTCCGCCGGGCATGCCTGTTCGAGCGTCATTATAACCACTCAA
GCCTGGCTTGGTATTGGGACCTGCTGCTACCGGCAGTCCCTAAAACTAGTGGCGGTGCCCGTAGGCTCTG
AGCGTAGTAATACTCCTCGCTATAGAGTCCTGCGAGTCCCCTGCCAGAACCCCCAAATTTTTACAGGTTG
ACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAA

Image

Caption
Image Tnsf 17103x2 ph1256 dm0054 640
Image Tnsf17103f

Map


Back