英語 [English] / 日本語 [Japanese]

MolliBase: Details of Record

Back


TNS:F:17105

Detail

Catalog number17105
Scientific nameMollisia sp.
GenusMollisia
Specific epithet
Infraspecific epithet
Taxon rank
Scientific name authorship
CountryJapan
LocalityKuni-mura, Gunma Pref.
Habitaton bamboo branch
Minimum elevation in meters1080.0
Decimal latitude36.64889
Decimal longitude138.61539
Year2004
Month5
Day15
Isolate IDFC-1009
Other isolate ID
Isolate statussingle
DNA sample IDED20091
NoteMLZ+ with KOH pretreatment; KOH reaction negative.

Sequence

Sequence ID4523
Region name
INSD Accession No. (DDBJ/NCBI/EMBL)
BOLD Accession No.
Sequence
>T_17105S4523
GAACCTGCGGAAGGATCATTAAATAAGGATGCCTTTATGGTATACCCCATCCGTGTCTATATACTCTTGT
TGCTTTGGCAGGCCGTGGTTTTTACCCTGTGGGCTTCTGCCTGCATGCGCCTGCCAGAGGACCAAACTCT
GAATTTAGTGATGTCTGAGTACTATATAATAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATC
GATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAA
CGCACATTGCGCCCAGTGGTATTCCGCCGGGCATGCCTGTTCGAGCGTCTCTATCAGCCATCACGTCTCG
GCGTGGAATTGGGGATTGCGGTATTCTGCTGCAGCCCTAAATCTCATAAGCGATATCAGTTGGTTCTAAG
CGTAGTAATATACCCCGCTACAGGACTTAGCTGGTCTTCTGCTGTAAATGGTGCAAGCCCATAATTAAGG
TTGACCTCGAATCAAGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGGGAA

Image

Caption
Image Tnsf 17105x2 ph1256 dm0060 640
Image Tnsf17105f

Map


Back