英語 [English] / 日本語 [Japanese]

MolliBase: Details of Record

Back


TNS:F:17107

Detail

Catalog number17107
Scientific namePyrenopeziza nervicola
GenusPyrenopeziza
Specific epithetnervicola
Infraspecific epithet
Taxon rank
Scientific name authorship
CountryJapan
LocalityKawarayu, Naganohara-machi, Gunma Pref.
Habitaton Quercus serrata subsp. serrata var. serrata leaf
Minimum elevation in meters650.0
Decimal latitude36.54594
Decimal longitude138.70514
Year2004
Month5
Day15
Isolate IDFC-1014
Other isolate ID
Isolate statussingle
DNA sample IDED20092
NoteMLZ+ with KOH pretreatment; KOH reaction positive.

Sequence

Sequence ID2815
Region name
INSD Accession No. (DDBJ/NCBI/EMBL)
BOLD Accession No.
Sequence
>T_17107S2815
AAGCAACAGTCCTTTCTGTAGCAGAGCTTAACGGAGACCTTGCACCCGAGAGGGGGGAGGCGACTATAAG
AGAACTCCCAGCGCAAGTCAGCACTGCTGGCAACACAATCGAACTGCGGGGACGCTTTAAGGCTCACCAG
TACCAACTGCTCTTAAGGGGGCAGGGCTAGCACAGCTAGAGGTCACAACCTGGTGGGATGCTACAATAAG
CAATCCGCAGCGGCTTACAGCCGTCCACAGACTAAGTGGTTGTGGGTAGGAGACCCCTACTTAAGATATA
GTCGGGCCCTGCAGGCTACTGCAGGGGCTTCTGCGTCCGTAGGTGAACCTGCGGAAGGATCATTATCAAG
GTTAAAGGTGGCGCTCCGGCGTCAACCGAACCCGTGTCTATCTACTCTTGTTGCTTTGGCAGGCCGTGGG
AAACCCCGCGGGCCTAGGCCTTCGAGCGCCTGCCAGAGGACCAAACTCTGAATTTTAGTGATGTCTGAGT
ACTATATAATAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAAT
GCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGGTGGT
ATTCCGCCGGGCATGCCTGTTCGAGCGTCATTATAACCACTCAAGCCTGGCTTGGTATTGGGACCTGCTG
CCACCGGCAGTCCCTAAAACTAGTGGCGGTGCCCGTAGGCTCTGAGCGTAGTAATACTCCTCGCTATAGA
GTCCTGCGGGTCCCCTGCCAAAACCCCCAAATTTTTACAGGTGACCT

Image

Caption
Image Tnsf 17107x2 ph1256 dm0070 640
Image Tnsf 17107x2 ph1256 dm0071 640
Image Tnsf17107f

Map


Back