英語 [English] / 日本語 [Japanese]

MolliBase: Details of Record

Back


TNS:F:17121

Detail

Catalog number17121
Scientific nameMollisia sp.
GenusMollisia
Specific epithet
Infraspecific epithet
Taxon rank
Scientific name authorship
CountryJapan
LocalityJogasaki, Ito-shi, Shizuoka Pref.
Habitaton unidentied wood
Minimum elevation in meters11.0
Decimal latitude34.87083
Decimal longitude139.10689
Year2004
Month7
Day25
Isolate IDFC-1018
Other isolate ID
Isolate statussingle
DNA sample IDED20093
NoteMLZ- with KOH pretreatment; KOH reaction negative.

Sequence

Sequence ID4527
Region name
INSD Accession No. (DDBJ/NCBI/EMBL)
BOLD Accession No.
Sequence
>T_17121S4527
CTGCGGAAGGATCATTAATCGGTGGATCTGGTACTGGGGGCCAGCGGGAGCGGCCGTGAGCAAAAATCCC
GCCGGATAGACCACACCCGTGTTTACCTACTCTTGTTGCTTTGGCGGGCCGTGGCCTCCACTACGGGCGC
TGCTCGTACGTGCCCGCCAGAGGACCAAACTCTGAATTATAGTGATGTCTGAGTACTATCTAATAGTTAA
AACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGA
ATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTGTGGTATTCCGCAGGGCATGC
CTGTTCGAGCGTCATTTAGACCACTCACGCCTGGCGTGGTATTGGGGCACGCGGTTCCGCGGCCCTCAAA
ATCAGTGGCGGCGCCGGTAGGCCCTAAGCGTAGTAAATCTCCTCGCTATAGGGTCCTCTCGGTGGCTCGC
CAGAACCCCCAACTTCTCAAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAAT
A

Image

Caption
Image Tnsf 17121x2 ph1257 dm0004 640
Image Tnsf17121f

Map


Back