英語 [English] / 日本語 [Japanese]

MolliBase: Details of Record

Back


TNS:F:17160

Detail

Catalog number17160
Scientific nameTapesia fusca
GenusTapesia
Specific epithetfusca
Infraspecific epithet
Taxon rank
Scientific name authorship(Pers.) Fuckel
CountryJapan
LocalityForest park, Ikaho-cho, Gunma Pref.
Habitaton unidentied wood
Minimum elevation in meters770.0
Decimal latitude36.49556
Decimal longitude138.92706
Year2004
Month8
Day5
Isolate IDFC-1031
Other isolate ID
Isolate statussingle
DNA sample IDED20136
NoteMLZ+ with or without KOH pretreatment; KOH reaction positive; Description given in Bull. Natl. Mus. Nat. Sci., Ser. B 35: 113-121. 2009.

Sequence

Sequence ID2195
Region name
INSD Accession No. (DDBJ/NCBI/EMBL)
BOLD Accession No.
Sequence
>T_17160S2195
CCCTTCTGTAGCAGAGCTTAACGGAGACCTTGCACCCGAGAGGGGGGAGGCGACTATAAACAAGCTTCCA
GCGCAAGTCAGCACCGCTGGCAACACAATCGAATTGCGGGGACGCTTTAAAGCCCACCGGTACCAACAGC
CCTTTTAAGGGCTGGGCGAGCATAGCTCGAGGTTACAACCCAGTGGGATGGTACAATAAGCAATCCGCAG
CGGCCGAGCCGTCCACAGACTAAGTGGTTGTGGGTAGGAGAACCCTATCTAAGATATAGTCGGGCCTGAG
GAGAGATCCCCGGGGCTTCTGCGTCCGTAGGTGAACCTGCGGAAGGATCATTAATAAGGATACCGGGAAA
CCGGTAGACCCACCCGTGTCTATCTACGCTTGTTGCTTTGGCAGGCCGTGGCCTCCACCGTGGGCTCTGC
CTGCGCGTGCCTGCCAGGGGACCAAACTCTGAATTTTAGTGATGTCTGAGTACTATATAATAGTTAAAAC
TTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATT
GCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGGTGGTATTCCGCCGGGCATGCCTG
TTCGAGCGTCATTATAACCACTCAAGCCTAGCTTGGTATTGGGGTTCGCGGTTACGCGGCTCCTAAAATC
AGTGGCGGTGCCGGTGGGCTCTAAGCGTAGTAAATCTCCTCGCTATAGGGTCCCTCTGGTTGCTTTGCCA
AAACCCCCAATTTTTATAGGTGACCTC

Image

Caption
Image Tnsf 17160x2 ph1267 dm0003 640
Image Tnsf17160f

Map


Back