英語 [English] / 日本語 [Japanese]

MolliBase: Details of Record

Back


TNS:F:17169

Detail

Catalog number17169
Scientific nameMollisia sp.
GenusMollisia
Specific epithet
Infraspecific epithet
Taxon rank
Scientific name authorship
CountryJapan
LocalityIchinokurasawa, Tanigawadake, Minakami-cho, Gunma Pref.
Habitaton Fallopia sachalinensis stem
Minimum elevation in meters900.0
Decimal latitude36.84758
Decimal longitude138.94278
Year2004
Month8
Day6
Isolate IDFC-1039
Other isolate ID
Isolate statussingle
DNA sample IDED20094
NoteMLZ+ with KOH pretreatment; KOH reaction negative.

Sequence

Sequence ID4532
Region name
INSD Accession No. (DDBJ/NCBI/EMBL)
BOLD Accession No.
Sequence
>T_17169S4532
ACCTGCGGAAGGATCATTAATAAAAGGATACCTTCGGGTATACCCCATCCGTGCCTATCTACTCTTGTTG
CTTTGGCAGGCCGTGGTCTCCACTCTGTGGGCTCTGCCTGCATGTGCCTGCCAGAGGACCAAATTCTGAA
TTTTAGTGATGTCTGAGTACTATATAATAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGA
TGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACG
CACATTGCACCCGGTGGTATTCCGCCGGGTATGCCTGTTCGAGCGTCATTACAACCACTCAAGCCTGGCT
TGGTGTTGGGGCCTGCAACTCTTGCAGCCCTAAAGTCCAGTGGCGGCCCCTCTGGGTTCTAAGCGTAGTA
ATTTCTCCTCGCTATAGAGTCCCCTGGGTGCTAGGCAGTAACCTGTCGCGCTCGTAAAAAACCCCCATTT
TATAGGTTGACCTCGGATCAAGTAGGGATACCCGCTGAACTTAAGCATATCAATA

Image

Caption
Image Tnsf 17169x2 ph1257 dm0009 640
Image Tnsf17169f

Map


Back