英語 [English] / 日本語 [Japanese]

MolliBase: Details of Record

Back


TNS:F:17321

Detail

Catalog number17321
Scientific nameMollisia sp.
GenusMollisia
Specific epithet
Infraspecific epithet
Taxon rank
Scientific name authorship
CountryJapan
LocalityMt. Morappu, Tomakomai-shi, Hokkaido
Habitaton Carpinus (?) leaf
Minimum elevation in meters220.0
Decimal latitude42.75303
Decimal longitude141.44347
Year2004
Month9
Day23
Isolate IDFC-1045
Other isolate ID
Isolate statussingle
DNA sample IDED20131
NoteMLZ+ with KOH pretreatment; KOH reaction negative.

Sequence

Sequence ID4676
Region name
INSD Accession No. (DDBJ/NCBI/EMBL)
BOLD Accession No.
Sequence
>T_17321S4676
TCCGTAGGGGGAACCTGCGGAAGGATCATTACAGAGTTCGTGCCCTTCGGGGTAGACCTCCCACCCTTTG
TATACATACCATTGTTGCTTCGGCGGCCCGCCGCAAGGCCCTCGGCTTCGGCTGGGGCGTGGCCGCCGGA
GGACCCCCAACCCTGAATTACAGTGTCGTCCGAGTACTATATAATAGTTAAAACTTTCAACAACGGATCT
CTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAAT
CATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGGGGGGCATGCCTCTTCCAGCGTCATTTCA
CCCCTCAAGCTCTGCTTGGTCTTGGGTCGCACCGCGCAAGCGGTGGGCCTCGAAAACAGTGGCGGCGCCA
TCTGGGCTCTCAGCGTAGTAATTCTTCTCGCTGTTGGGCTCCGGTGGCCGCCCGCCAGCAACCCCCAACT
TTTACAGTTTGACCTGGGATGAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAA

Image

Caption
Image Tnsf 17321x2 ph1257 dm0014 640
Image Tnsf17321f

Map


Back