英語 [English] / 日本語 [Japanese]

MolliBase: Details of Record

Back


TNS:F:17329

Detail

Catalog number17329
Scientific nameMollisia sp.
GenusMollisia
Specific epithet
Infraspecific epithet
Taxon rank
Scientific name authorship
CountryJapan
LocalityMt. Morappu, Tomakomai-shi, Hokkaido
Habitaton unidentified wood
Minimum elevation in meters220.0
Decimal latitude42.75303
Decimal longitude141.44347
Year2004
Month9
Day23
Isolate IDFC-1051
Other isolate ID
Isolate statussingle
DNA sample IDED20095
NoteMLZ- with KOH pretreatment; KOH reaction negative.

Sequence

Sequence ID4533
Region name
INSD Accession No. (DDBJ/NCBI/EMBL)
BOLD Accession No.
Sequence
>T_17329S4533
CCTGCGGAGGGATCATTACAGAGTTCATGCCCTTACGGGTAGATCTCCCACCCTGTGTTATTATTACCTT
TGTTGCTTTGGCGGGCCGCCCGGCCTCGGCCAGGCTACCGGCTCCGGCTGGTAAGCGCCCGCCAGAGGAC
CCCAAACCCTGAATGTTAGTGTCGTCTGAGTACTATATAATAGTTAAAACTTTCAACAACGGATCTCTTG
GTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATC
GAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATTACAACCC
TCAAGCAATGCTTGGTGTTGGGCCCCGCCGCTCACCCGGCGGGCTCTAAAATCAGTGGCGGTGCCGTCGG
GCTCTGAGCGTAGTAATTCTTCTCGCTATAGGGTCCCGGTGGATGCTGGCCAACAACCCCCAATTTTCTA
TGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAAAA

Image

Caption
Image Tnsf 17329x2 ph1257 dm0022 640
Image Tnsf17329f

Map


Back