英語 [English] / 日本語 [Japanese]

MolliBase: Details of Record

Back


TNS:F:17332

Detail

Catalog number17332
Scientific nameMollisia sp.
GenusMollisia
Specific epithet
Infraspecific epithet
Taxon rank
Scientific name authorship
CountryJapan
LocalityMt. Morappu, Tomakomai-shi, Hokkaido
Habitaton unidentified wood
Minimum elevation in meters220.0
Decimal latitude42.75303
Decimal longitude141.44347
Year2004
Month9
Day23
Isolate IDFC-1056
Other isolate ID
Isolate statussingle
DNA sample IDED20096
NoteMLZ+ with KOH pretreatment; KOH reaction negative.

Sequence

Sequence ID4535
Region name
INSD Accession No. (DDBJ/NCBI/EMBL)
BOLD Accession No.
Sequence
>T_17332S4535
TTCCGTAGGTGAACCTGCGGAAGGATCATTACCCAGGAGATACCTTTATGGTATAGCCCATCCGTGTCTA
TATACTCTTGTTGCTTTGGCAGGCCGTGCCTTACCGCCTGTGGGCTTCTGCCTGCATGTGCCTGCCAGAG
GACCAAACTCTGAATTTTAGTGATGTCTGAGTACTATATAATAGTTAAAACTTTCAACAACGGATCTCTT
GGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCAT
CGAATCTTTGAACGCACATTGCGCCCGGTGGTATTCCGCCGGGCATGCCTGTTCGAGCGTCTCTATCAAC
CATCACGCCCCCGGCGTGGAACTGGGGATTGCAGTTTGCTGCAGCCCTAAATCTCATATGCGATCCCAGT
TGGTTCTATGCGTAGTACATACCCCGCTACAGAACTTTAATTGGAGCCGTCGGCAGTAAATGGTGCAAGC
CCATTCTTAAGGTTGACCTCGAATCAAGTAGGGATACCCGCTGAACTTAAGCATATCAATA

Image

Caption
Image Tnsf 17332x2 ph1257 dm0018 640
Image Tnsf17332f

Map


Back