英語 [English] / 日本語 [Japanese]

MolliBase: Details of Record

Back


TNS:F:17359

Detail

Catalog number17359
Scientific nameMollisia sp.
GenusMollisia
Specific epithet
Infraspecific epithet
Taxon rank
Scientific name authorship
CountryJapan
LocalityLarix-Pinus forest, Yanagawa, Chino City, Nagano Pref.
Habitaton Pinus leaf
Minimum elevation in meters1380.0
Decimal latitude35.98333
Decimal longitude138.28641
Year2004
Month10
Day13
Isolate IDFC-1071
Other isolate ID
Isolate statussingle
DNA sample IDED20097
NoteMLZ+ with KOH pretreatment; KOH reaction negative.

Sequence

Sequence ID4536
Region name
INSD Accession No. (DDBJ/NCBI/EMBL)
BOLD Accession No.
Sequence
>T_17359S4536
CTTCCGTAGGGGGAACCTGCGGAAGGATCATTATGGTGTAACCAAGCTCTCGCAAAGCCACTGTTGGTAG
AGGATCTTCCTCCCGAAACAGGCAGTGACTGCGGGGGGGCATTGGCCTAACTCACACCCTTGAATACACT
ACCTTTGTTGCTTTGGCGGGCCGCCCTTCGGGGCGTGGGCCCCGGCTCACCGCGCCCGCCAGAGGACCAA
AACTCTTTTGTTTAGTGATGTCTGAGTACTATATAATAGTTAAAACTTTCAACAACGGATCTCTTGGTTC
TGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAAT
CTTTGAACGCACATTGCGCCCTCTGGTATTCCGGAGGGCATGCCTGTTCGAGCGTCATTATGACCAATCA
AGCACTGCTTGGTATTGGGGCCCGCTGTACCGGCGGCCCTTAAAAACAGTGGCGGTGCCGTCTGGCTCTC
AGCGTAGTAATTTTTCTCGCTATTGGGCCCGGTGGTTACCTGCCAAAACCCCCAACTTTCTTAGGTTGAC
CTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAA

Image

Caption
Image Tnsf 17359x2 ph1258 dm0003 640
Image Tnsf 17359x2 ph1258 dm0004 640
Image Tnsf17359f

Map


Back