英語 [English] / 日本語 [Japanese]

MolliBase: Details of Record

Back


TNS:F:17380

Detail

Catalog number17380
Scientific nameMollisia sp.
GenusMollisia
Specific epithet
Infraspecific epithet
Taxon rank
Scientific name authorship
CountryJapan
LocalityAlnus forest, Minoto, Chino City, Nagano Pref.
Habitaton Alnus leaf
Minimum elevation in meters1500.0
Decimal latitude35.98333
Decimal longitude138.30258
Year2004
Month10
Day14
Isolate IDFC-1073
Other isolate ID
Isolate statussingle
DNA sample IDED20132
NoteMLZ+ with KOH pretreatment; KOH reaction negative.

Sequence

Sequence ID2821
Region name
INSD Accession No. (DDBJ/NCBI/EMBL)
BOLD Accession No.
Sequence
>T_17380S2821
AACAAGTGATTCTTCCGCTGTGACACTTATAGAAGCCTTTGCGAGTCCGAAAAGACTTGTTACCGCGACT
CAAAAAACTGGTAACTTTGCGCAAGTCAATGTAGGTTGGCAACATAATCGAATTGCGGGAAGCCCTAAAG
CCCGACAGTACTAACTATCTATAGAAATGTAGGTAGGGCCTGTGTTAACTGCACAGGGTAGTAAAAACCT
GTCGGGATGTACAATGGGTAATCCGCAGCGAAGCTCCTAAGGGCATACTGCCTATGGGGAACGTTCACAG
ACTAAGTGGTTATGGACAGGGTATTGTACCTTGTTTAAGATATAGTCGGGTCCCTCGGGAAACCAAGGGA
GTAAGTCATAGCACAGTCAGATAGTGTGTTCTTTCGCACTCTGATGATAACCGTTCCGTTGGTGAACCAG
CGGAAGGATCATTACAGAGATCATGCCCTCACGGGTAGACCTCCCACCCTGTGTTATTTACTATTGTTGC
TTTGGCAGGCCGCCTTCGGGCTCCCGGCTCTCGCTGGGGTGCGCCTGCCAGAGGACCCCAACTCTGTGTT
TAGTGTCGTCTGAGTACTATATAATAAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATG
AAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCA
CATTGCGCCCCTTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTCAGCTTGG
TCTTGGGCCCTGCCGGCAACGGCTGGCCTTAAAAGCAGTGGCGGTGCTATCGAGCTCTACGCGTAGTAAT
TAAACCCTCGCGATTGAGTCTCGGTGGACGCTGGCCAGCAACCCCCAATTTTCTATGGTGACC

Image

Caption
Image Tnsf 17380x2 ph1253 dm0018 640
Image Tnsf 17380x2 ph1258 dm0009 640
Image Tnsf17380f

Map


Back