英語 [English] / 日本語 [Japanese]

MolliBase: Details of Record

Back


TNS:F:17381

Detail

Catalog number17381
Scientific nameMollisia sp.
GenusMollisia
Specific epithet
Infraspecific epithet
Taxon rank
Scientific name authorship
CountryJapan
LocalityAlnus forest, Minoto, Chino City, Nagano Pref.
Habitaton Quercus crispula var. crispula leaf
Minimum elevation in meters1500.0
Decimal latitude35.98333
Decimal longitude138.30258
Year2004
Month10
Day14
Isolate IDFC-1074
Other isolate ID
Isolate statussingle
DNA sample IDED20098
NoteMLZ+ with KOH pretreatment; MLZ- without KOH pretreatment; KOH reaction negative.

Sequence

Sequence ID4537
Region name
INSD Accession No. (DDBJ/NCBI/EMBL)
BOLD Accession No.
Sequence
>T_17381S4537
ATCCTTCCGTAAGGGGGACCTGCGGAAGGATCATTACAGAGATCATGCCCTCACGGGTAGACCTCCCACC
CTGTGTTATTTACTATTGTTGCTTTGGCAGGCCGCCTTCGGGCTCCCGGCTCTCGCTGGGGTGCGCCTGC
CAGAGGACCCCAACTCTGTGTTTAGTGTCGTCTGAGTACTATATAATAAGTTAAAACTTTCAACAACGGA
TCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTG
AATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATT
TCAACCCTCAAGCTCAGCTTGGTCTTGGGCCCTGCCGGCAACGGCTGGCCTTAAAAGCAGTGGCGGTGCT
ATCGAGCTCTACGCGTAGTAATTAAACCCTCGCGATTGAGTCTCGGTGGACGCTGGCCAGCAACCCCCAA
TTTTCTATGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAA

Image

Caption
Image Tnsf 17381x2 ph1267 dm0008 640
Image Tnsf17381f

Map


Back