英語 [English] / 日本語 [Japanese]

MolliBase: Details of Record

Back


TNS:F:17389

Detail

Catalog number17389
Scientific nameMollisia sp.
GenusMollisia
Specific epithet
Infraspecific epithet
Taxon rank
Scientific name authorship
CountryJapan
LocalityAlnus forest, Minoto, Chino City, Nagano Pref.
Habitaton herb stem
Minimum elevation in meters1500.0
Decimal latitude35.98333
Decimal longitude138.30258
Year2004
Month10
Day14
Isolate IDFC-1079
Other isolate ID
Isolate statussingle
DNA sample IDED20099
NoteMLZ+ with KOH pretreatment; KOH reaction negative.

Sequence

Sequence ID4538
Region name
INSD Accession No. (DDBJ/NCBI/EMBL)
BOLD Accession No.
Sequence
>T_17389S4538
CCTTCCGTAGGTGAACCTGCGGAAGGATCATTACAGAGTTCATGCCCTTCGGGGTAGACCTCCCACCCTT
TGTATACATTGCCTTTGTTGCTTTGGCGGGCCGCCTTTTGGCCACCGGCTCCGGCTGGTGCGCGCCCGCC
AGAGAACCCAAACCCTGTCTTACAGTGTCGTCCGAGTACTATATAATAGTTAAAACTTTCAACAACGGAT
CTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAATTAATGTGAATTGCAGAATTTAGTGA
ATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTT
CAACCCTCAAGCTCTGCTTGGTCTTGGGCCGCGCCGGCAACGGCGGGCCTCAAAAACAGTGGCGGCGCCA
TCGTGTCCCTCAGCGTAGTAATTCTTCTCGCTGTTGGGTCCCGGTGGCCGCTGGCCAGCAACCCCCAATT
TTTCTATGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGA

Image

Caption
Image Tnsf 17389x2 ph1258 dm0015 640
Image Tnsf17389f

Map


Back