英語 [English] / 日本語 [Japanese]

MolliBase: Details of Record

Back


TNS:F:17401

Detail

Catalog number17401
Scientific nameMollisia sp.
GenusMollisia
Specific epithet
Infraspecific epithet
Taxon rank
Scientific name authorship
CountryJapan
LocalityQuercus Alnus forest, Furusato-no-mori, Yachiho-mu, Nagano Pref.
Habitaton Quercus crispula var. crispula wood
Minimum elevation in meters1680.0
Decimal latitude36.06802
Decimal longitude138.39108
Year2004
Month10
Day15
Isolate IDFC-1085
Other isolate ID
Isolate statussingle
DNA sample IDED20100
NoteMLZ+ with KOH pretreatment; KOH reaction negative.

Sequence

Sequence ID4539
Region name
INSD Accession No. (DDBJ/NCBI/EMBL)
BOLD Accession No.
Sequence
>T_17401S4539
CTTCCGTAGGGGGTACCTGCGGAGGGATCATTACAGAGTTCGTGCCCTTGCGGGTAGATCTCCCACCCTG
TGTTATTATCGCTCTTGTTGCTTTGGCGGGCCGCCCGGCTCCAGCCAGGCTACCGGCCCCCGCTGGTAAG
CGCCCGCCAGAGGACTCGAAACCCTGAATGTCAGCGTCGTCTGAGTACTATATAATAGTTAAAACTTTCA
ACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGA
ATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTACTCCGAGGGGCATGCCTGTTCGA
GCGTCATTACACCCCTCAAGCAACGCTTGGTATTGGGCCCCGCCGCTGACCCGGCGGGCTCTAAAATCAG
TGGCGGTGCCGTCGGGCTCTGAGCGTAGTAACTCCTCTCGCTACAGAGTCCCGGTGGATGCTGGCCAGCA
ACCCCCAACTTTCTATGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAAAA

Image

Caption
Image Tnsf 17401x2 ph1258 dm0027 640
Image Tnsf17401f

Map


Back