英語 [English] / 日本語 [Japanese]

MolliBase: Details of Record

Back


TNS:F:17403

Detail

Catalog number17403
Scientific nameMollisia sp.
GenusMollisia
Specific epithet
Infraspecific epithet
Taxon rank
Scientific name authorship
CountryJapan
LocalityQuercus Alnus forest, Furusato-no-mori, Yachiho-mu, Nagano Pref.
Habitaton unidentified wood
Minimum elevation in meters1680.0
Decimal latitude36.06802
Decimal longitude138.39108
Year2004
Month10
Day15
Isolate IDFC-1087
Other isolate ID
Isolate statussingle
DNA sample IDED20101
NoteMLZ+ with KOH pretreatment; MLZ- without KOH pretreatment; KOH reaction negative.

Sequence

Sequence ID4540
Region name
INSD Accession No. (DDBJ/NCBI/EMBL)
BOLD Accession No.
Sequence
>T_17403S4540
CCTGCGGAAGGATCATTAATCGGTGGATCTGGTACTGGGGGCCAGCGGGAGCGGCCGTGAGCAAAAATCC
CGCCGGATAGACCACACCCGTGTTTACCTACTCTTGTTGCTTTGGCGGGCCGTGGCCTTCCACTACGGGC
GCTGCTCGTACGTGCCCGCCAGAGGACCAAACTCTGAATTATAGTGATGTCTGAGTACTATCTAATAGTT
AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGT
GAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTGTGGTATTCCGCAGGGCAT
GCCTGTTCGAGCGTCATTTAGACCACTCACGCCTGGCGTGGTATTGGGGCACGCGGTTCCGCGGCCCTCA
AAATCAGTGGCGGCGCCGGTAGGCCCTAAGCGTAGTAAATCTCCTCGCTATAGGGTCCTCTCGGTGGCTT
GCCAGAACCCCCAACTTCTCAAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCA
ATA

Image

Caption
Image Tnsf 17403x2 ph1267 dm0012 640
Image Tnsf17403f

Map


Back