英語 [English] / 日本語 [Japanese]

MolliBase: Details of Record

Back


TNS:F:17415

Detail

Catalog number17415
Scientific nameMollisia sp.
GenusMollisia
Specific epithet
Infraspecific epithet
Taxon rank
Scientific name authorship
CountryJapan
LocalityTaraigoyazawa, plot No. T4, Susugaya, Kiyokawamura, Kanagawa Pref.
Habitaton unidentified wood
Minimum elevation in meters660.0
Decimal latitude35.45058
Decimal longitude139.1973
Year2005
Month4
Day16
Isolate IDFC-1118
Other isolate ID
Isolate statussingle
DNA sample IDED20102
NoteMLZ- with KOH pretreatment; KOH reaction negative.

Sequence

Sequence ID4543
Region name
INSD Accession No. (DDBJ/NCBI/EMBL)
BOLD Accession No.
Sequence
>T_17415S4543
CCTTCCGTAGGGGAACCTGCGGAAGGATCATTAATCAGTGGATCCGGCGGGGAACCCCCCCGCCGGGTAG
ACCTCCACCCGTGCTTACCTACTCTTGTTGCTTTGGCGGGCCGTGGCCTCCACTACGGGCTCTGTTCGTA
CGTGCCCGCCAGAGGACCAAACTCTGAATTTTAGTGATGTCTGAGTACTATTTAATAGTTAAAACTTTCA
ACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGA
ATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTGTGGTATTCCGCAGGGCATGCCTGTTCGA
GCGTCATTTAGACCACTCACGCCTAGCGTGGTATTGGGGCACGCGGTCCCGCGGCCCTCAAAATCAGTGG
CGGCGCCGGTAGGCCCTAAGCGTAGTAAATCTCCTCGCTATAGGGTCCTCTCGGTGGCTCGCCAGAACCC
CCAACTTCTTAAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAA

Image

Caption
Image Tnsf 17415x2 ph1258 dm0045 640
Image Tnsf 17415x2 ph1258 dm0048 640
Image Tnsf17415f

Map


Back