英語 [English] / 日本語 [Japanese]

MolliBase: Details of Record

Back


TNS:F:17424

Detail

Catalog number17424
Scientific namePyrenopeziza protrusa
GenusPyrenopeziza
Specific epithetprotrusa
Infraspecific epithet
Taxon rank
Scientific name authorship(Berk. & M.A. Curtis) Sacc.
CountryJapan
LocalityIchinosawatouge, Susugaya, Kiyokawamura, Aikou-gun, Kanagawa Pref.
Habitaton Magnolia hypoleuca leaf
Minimum elevation in meters440.0
Decimal latitude35.46933
Decimal longitude139.21833
Year2005
Month4
Day16
Isolate IDFC-1124
Other isolate ID
Isolate statussingle
DNA sample IDED20089
NoteMLZ+ with or without KOH pretreatment; KOH reaction negative.

Sequence

Sequence ID4483
Region name
INSD Accession No. (DDBJ/NCBI/EMBL)
BOLD Accession No.
Sequence
>T_17424S4483
ATCCTTCCGTAGGGGGAACCTGCGGAAGGATCATTACCAGGTTAACGGTGCATCCGCGAGAGCCGGTGCT
ACCAAACCCGTGTCTATATACTATTGTTGCTTTGGCAGGCCGTGGGAAACCACTGTGGGCTTCGGTCTGC
AAGTGCCTGCCAGAGGACCAAACTCTGAATGTTAGTGATGTCTGAGTACTATATAATAGTTAAAACTTTC
AACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAG
AATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTGTGGCATTCCGCAGGGCATGCCTGTTCG
AGCGTCATTACAACCACTCAAGCCTAGCTTGGTATTGGGACTCGCTGTAACTGGCGGTCCCTAAAATCAG
TGGCGGTGCCTGTAGGCTCTGAGCGTAGTAAAACTTCTCGCTATAGAGTCCTGCAGGTTCCCTGCCAGAA
CCCCCAAATTTTTACAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGC
GGAGGGGAAGG

Image

Caption
Image Tnsf 17424x2 ph1267 dm0014 640
Image Tnsf17424f

Map


Back