英語 [English] / 日本語 [Japanese]

MolliBase: Details of Record

Back


TNS:F:17439

Detail

Catalog number17439
Scientific namePyrenopeziza nervicola
GenusPyrenopeziza
Specific epithetnervicola
Infraspecific epithet
Taxon rank
Scientific name authorship
CountryJapan
LocalityTanzawako visitor Center, Yamakita-machi, Kanagawa Pref.
Habitaton Zelkova wood
Minimum elevation in meters380.0
Decimal latitude35.41624
Decimal longitude139.06941
Year2005
Month4
Day17
Isolate IDFC-1136
Other isolate ID
Isolate statussingle
DNA sample IDED20103
NoteMLZ+ with KOH pretreatment; KOH reaction negative.

Sequence

Sequence ID4548
Region name
INSD Accession No. (DDBJ/NCBI/EMBL)
BOLD Accession No.
Sequence
>T_17439S4548
TCCTTCCGTAGGGGGAACCTGCGGAAGGATCATTATCAAGGTTAAAGGTGACGCTCCGGCGTCAACCGAA
CCCGTGTCTATCTACTCTTGTTGCTTTGGCAGGCCGTGGGAAACCCCGCGGGCCTAGGCCTTCGAGCGCC
TGCCAGAGGACCAAACTCTGAATTTTAGTGACGTCTGAGTACTATATAATAGTTAAAACTTTCAACAACG
GATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAG
TGAATCATCGAATCTTTGAACGCACATTGCGCCCGGTGGTATTCCGCCGGGCATGCCTGTTCGAGCGTCA
TTATAACCACTCAAGCCTGGCTTGGTATTGGGACCTGCTGCCACCGGCAGTCCCTAAAACTAGTGGCGGT
GCCCGTAGGCTCTGAGCGTAGTAATACTCCTCGCTATAGAGTCCTGCGGGTCCCCTGCCAAAACCCCCAA
ATTTTTACAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAA

Image

Caption
Image Tnsf 17439x2 ph1258 dm0053 640
Image Tnsf17439f

Map


Back