英語 [English] / 日本語 [Japanese]

MolliBase: Details of Record

Back


TNS:F:17461

Detail

Catalog number17461
Scientific nameMollisia sp.
GenusMollisia
Specific epithet
Infraspecific epithet
Taxon rank
Scientific name authorship
CountryJapan
LocalityKakuma, Sanada-machi, Nagano Pref.
Habitaton Prunus wood
Minimum elevation in meters1305.0
Decimal latitude36.45408
Decimal longitude138.36525
Year2005
Month4
Day29
Isolate IDFC-1138
Other isolate ID
Isolate statussingle
DNA sample IDED20105
NoteMLZ+ with KOH pretreatment; KOH reaction negative.

Sequence

Sequence ID4550
Region name
INSD Accession No. (DDBJ/NCBI/EMBL)
BOLD Accession No.
Sequence
>T_17461S4550
CCTTCCGTAGGGGAACCTGCGGAAGGATCATTAATCAGTGGATCCGGCGGGGACCTCCCCGCCGGGTAGA
CCTCCACCCGTGCCTATCTACTCTTGTTGCTTTGGCGGGCCGTGGCCTCCACTACGGGCTCTGCTCGTAC
GTGCCCGCCAGAGGACCAAACTCTGAATTTTAGTGATGTCTGAGTACTATTTAATAGTTAAAACTTTCAA
CAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAA
TTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTGTGGTATTCCGCAGGGCATGCCTGTTCGAG
CGTCATTTAGACCACTCACGCCTGGCGTGGTATTGGGGCACGCGGTTCCGCGGCCCTCAAAATCAGTGGC
GGCGCCGGTAGGCCCTAAGCGTAGTAAATCTCCTCGCTATAGGGTCCTCTCGGTGGCTCGCCAGAACCCC
CCAACTTCTCAAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAA

Image

Caption
Image Tnsf 17461x4 ph1259 dm0007 640
Image Tnsf17461f

Map


Back