英語 [English] / 日本語 [Japanese]

MolliBase: Details of Record

Back


TNS:F:17463

Detail

Catalog number17463
Scientific nameTapesia fusca
GenusTapesia
Specific epithetfusca
Infraspecific epithet
Taxon rank
Scientific name authorship(Pers.) Fuckel
CountryJapan
LocalitySugadaira Montane Research Center, University of Tsukuba, Ueda City, Nagano Pref.
Habitaton unidentied wood
Minimum elevation in meters1269.0
Decimal latitude36.51933
Decimal longitude138.35305
Year2005
Month4
Day29
Isolate IDFC-1139
Other isolate ID
Isolate statussingle
DNA sample IDED20133
NoteMLZ+ withKOH pretreatment;MLZ- without KOH pretreatment; KOH reaction positive; Description given in Bull. Natl. Mus. Nat. Sci., Ser. B 35: 113-121. 2009.

Sequence

Sequence ID4681
Region name
INSD Accession No. (DDBJ/NCBI/EMBL)
BOLD Accession No.
Sequence
>T_17463S4681
ATCCTTCCCGTAAGGGGGACCTGCGGAAGGATCATTAAAAAGATCAACCCGGTTGTGAAGTCAATGCCTT
ACCGGCCTTGTGGGGCTGTCTTAAACTCACAGCAATGCCAATTGACAAGTCATGCCTGTTTACAGGCCTT
GTGGGGCTGTTTTAAACTCACAGCAATACCAGTGACACACACTCATACCGGGGGCTTCGACCCCCGGGCC
GGTTGAATCCCACCCGTGTCTACATACTCTTGTTGCTTTGGCAGGCCGTGGTCTCCACTGTGGGCTCTGC
CTGCATGTGCCTGCCAGAGGACCAAACTCTGAATTTTAGTGATGTCTGAGTACTATATAATAGTTAAAAC
TTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATT
GCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTGTGGTATTCCGCAGGGCATGCCTG
TTCGAGCGTCATTATAACCACTCAAGCTTGGCTTGGTATTGGAGTTTGCGGTTCCGCAGCTCCTAAAATC
AGTGGCGGTGCCGGTGTGGCTCTACGCGTAGTAATTCTTCTCGCGATGGAGTTCCCCTGGTTGCTTGCCA
GAACCCCCCAATTTTTACAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAA

Image

Caption
Image Tnsf 17463x2 ph1267 dm0016 640
Image Tnsf17463f

Map


Back