英語 [English] / 日本語 [Japanese]

MolliBase: Details of Record

Back


TNS:F:17464

Detail

Catalog number17464
Scientific nameMollisia sp.
GenusMollisia
Specific epithet
Infraspecific epithet
Taxon rank
Scientific name authorship
CountryJapan
LocalitySugadaira Montane Research Center, University of Tsukuba, Ueda City, Nagano Pref.
Habitaton unidentied wood
Minimum elevation in meters1269.0
Decimal latitude36.51933
Decimal longitude138.35305
Year2005
Month4
Day29
Isolate IDFC-1141
Other isolate ID
Isolate statussingle
DNA sample IDED20106
NoteMLZ+ with KOH pretreatment; KOH reaction negative.

Sequence

Sequence ID4552
Region name
INSD Accession No. (DDBJ/NCBI/EMBL)
BOLD Accession No.
Sequence
>T_17464S4552
ATCCTTCCGTAGGGGAACCTGCGGAAGGATCATTACCCAAAAGGATACTTCGGTATACCCAACCCGTGTC
TATCTACTCTTGTTGCTTTGGCAGGCTGTGGTTAATCCACTGCGGGCTCTTGCCTGTACATTCGTCTGCC
AGAGGACCAAACTCTGAATTTTAGTGATGTCTGAGTACTATATAATAGTTAAAACTTTCAACAACGGATC
TCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAA
TCATCGAATCTTTGAACGCACATTGCGCCCTGTGGTATTCCGCAGGGCATGCCTGTTCGAGCGTCATTAT
AGCCAATTAAGCCTAGCTTAGTATTGGGGCTCGCGGTCTCGCGGCCTCTAAAACCAGTGGCGGTGCCGGT
AGGCTCTGAGCGTAGTAATACTCCTCGCTATAGAGTCCTGTCGGTTCCCTGCCAGAACCCCCATATTTTA
TCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGGG

Image

Caption
Image Tnsf 17464x2 ph1259 dm0012 640
Image Tnsf 17464x2 ph1259 dm0013 640
Image Tnsf17464f

Map


Back