英語 [English] / 日本語 [Japanese]

MolliBase: Details of Record

Back


TNS:F:17700

Detail

Catalog number17700
Scientific nameMollisia sp.
GenusMollisia
Specific epithet
Infraspecific epithet
Taxon rank
Scientific name authorship
CountryJapan
LocalityFuji 2-gome, Fujiyoshida-shi, Yamanashi Pref.
Habitaton unidentied wood
Minimum elevation in meters1647.0
Decimal latitude35.41572
Decimal longitude138.70009
Year2006
Month10
Day14
Isolate IDFC-1472
Other isolate ID
Isolate statussingle
DNA sample IDED20129
NoteMLZ+ with or without KOH pretreatment; KOH reaction negative.

Sequence

Sequence ID4603
Region name
INSD Accession No. (DDBJ/NCBI/EMBL)
BOLD Accession No.
Sequence
>T_17700S4603
TCCTTCCGTAGGGGGAACCTGCGGAAGGATCATTAATAAAAGGATACCTTCGGGTATACCCCATCCGTGT
CTATCTACTCTTGTTGCTTTGGCAGGCCGTGGTCTCCCACTGTGGGCTCTGCCTGCATGTGCCTGCCAGA
GGACCAAACTCTGAATTTTAGTGATGTCTGAGTACTATATAATAGTTAAAACTTTCAACAACGGATCTCT
TGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCA
TCGAATCTTTGAACGCACATTGCACCCGGTGGTATTCCGCCGGGTATGCCTGTTCGAGCGTCGTAAGAAC
AACACAAATGACCAAGCTTAGGCTTGATGTTGGGGTTGCGGCTTTGGCTGCAGCCCTCAAGTCCACGGGC
GGTTCCGATAGGTTCTACGCGTAGTAATTTCTCCTCGCTATAGAGTCTACCGGCGCATTTGGAAGTAAGT
CCAGCAATGGCAGCGCCAGGCCCTTAAACCTTCAATCAGTTTGACCTCGGATCAAGTAGGGATACCCGCT
GAACTTAAGCATATCAATAAGCGGAGGAGGAAGG

Image

Caption
Image Tnsf 17770x2 ph1267 dm0019 640
Image Tnsf17700f

Map


Back