英語 [English] / 日本語 [Japanese]

MolliBase: Details of Record

Back


TNS:F:17735

Detail

Catalog number17735
Scientific nameMollisia sp.
GenusMollisia
Specific epithet
Infraspecific epithet
Taxon rank
Scientific name authorship
CountryJapan
LocalityOirase, Towadako-machi, Aomori Pref.
Habitaton Cercidiphyllum japonicum branch
Minimum elevation in meters258.0
Decimal latitude40.53977
Decimal longitude140.97608
Year2005
Month6
Day23
Isolate IDFC-1166
Other isolate ID
Isolate statussingle
DNA sample IDED20107
NoteMLZ+ with KOH pretreatment; KOH reaction negative.

Sequence

Sequence ID4553
Region name
INSD Accession No. (DDBJ/NCBI/EMBL)
BOLD Accession No.
Sequence
>T_17735S4553
ATCCTTCCGTAGGGGAACCTGCGGAAGGATCATTACCCAAAAGGATACTTCGGTATACCCAACCCGTGTC
TATCTACTCTTGTTGCTTTGGCAGGCTGTGGTTAATCCACTGCGGGCTCTTGCCTGTACATTCGTCTGCC
AGAGGACCAAACTCTGAATTTTAGTGATGTCTGAGTACTATATAATAGTTAAAACTTTCAACAACGGATC
TCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAA
TCATCGAATCTTTGAACGCACATTGCGCCCTGTGGTATTCCGCAGGGCATGCCTGTTCGAGCGTCATTAT
AGCCAATTAAGCCTAGCTTAGTATTGGGGCTCGCGGTCTCGCGGCCTCTAAAACCAGTGGCGGTGCCGGT
AGGCTCTGAGCGTAGTAATACTCCTCGCTATAGAGTCCTGTCGGTTCCCTGCCAGAACCCCCATATTTTA
TCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGGG

Image

Caption
Image Tnsf 17735x2 ph1259 dm0020 640
Image Tnsf 17735x2 ph1259 dm0021 640
Image Tnsf17735f

Map


Back