英語 [English] / 日本語 [Japanese]

MolliBase: Details of Record

Back


TNS:F:17755

Detail

Catalog number17755
Scientific nameMollisia sp.
GenusMollisia
Specific epithet
Infraspecific epithet
Taxon rank
Scientific name authorship
CountryJapan
LocalityLake Towada, Towadako-machi, Aomori Pref.
Habitaton Quercus crispula var. crispula branch
Minimum elevation in meters430.0
Decimal latitude40.43319
Decimal longitude140.88911
Year2005
Month6
Day24
Isolate IDFC-1176
Other isolate ID
Isolate statussingle
DNA sample IDED20088
NoteMLZ+ with KOH pretreatment; KOH reaction negative.

Sequence

Sequence ID424
Region name
INSD Accession No. (DDBJ/NCBI/EMBL)
BOLD Accession No.
Sequence
>T_17755S424
TCCGTAGGTGAACCTGCGGAAGGATCATTAATAAGGACCCCTAGGGTAACCAATCCCTAGGAGTACCCCA
CCCGTGTCTATCTACTCTTGTTGCTTTGGCAGGCCGTGGCCTCCACTGCGGGCTCTGCTTGCATGTGTCT
GCCAGAGGATCAAACTCTGAATATTAGTGATGTCTGAGTACTATATAATAGTTAAAACTTTCAACAACGG
ATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGT
GAATCATCGAATCTTTGAACGCACATTGCGCCCTGTGGTATTCCGCAGGGCATGCCTGTTCGAGCGTCAT
TATAACCATTCAAGCTCAGCTTGGTATTGGAGCTTGCGATCGCGCAGCCCCTAAAATCAGTGGCGGTGCC
AGTGGGCTCTACGCGTAGTACATCTCCTCGCGATTGAGTACCTCTGTGTTCTTGCCAGAATTCTTCATTT
TCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGA

Image

Caption
Image Tnsf 17755x2 ph1259 dm0025 640
Image Tnsf17755f

Map


Back