英語 [English] / 日本語 [Japanese]

MolliBase: Details of Record

Back


TNS:F:17758

Detail

Catalog number17758
Scientific nameMollisia sp.
GenusMollisia
Specific epithet
Infraspecific epithet
Taxon rank
Scientific name authorship
CountryJapan
LocalityMikuniyama, Yozuku, Ashigarakami-gun, Kanagawa Pref.
Habitaton unidentified branch
Minimum elevation in meters780.0
Decimal latitude35.42503
Decimal longitude138.97411
Year2005
Month7
Day2
Isolate IDFC-1179
Other isolate ID
Isolate statussingle
DNA sample IDED20108
NoteMLZ+ with KOH pretreatment; KOH reaction negative.

Sequence

Sequence ID2816
Region name
INSD Accession No. (DDBJ/NCBI/EMBL)
BOLD Accession No.
Sequence
>T_17758S2816
GTCCTTCTGTAGCAGAGCTTAACGGAGACCTTGCACCCGAGAGGGGGGAGGCGACTATAAAGAACTCCCA
GCGCAAGTCAGTACTGCTGGCAACACAATCGAATTGCGGGGACGCTTTAAGGCTCACCAGTACCAACTAC
CCTCCGGGTAGGGCTAGCACGGCTAGAGGTCACAACCTGGTGAGATGTTGCAATAAGCAATCCGCAGCGG
CTCAGCCGTCCACAGACTAAGTGGTTGTGGGTAGGAGATCCCTACTTAAGATATAGTCGGGCCTTGTGGG
CAACCACAGGGAGTCTGCGTCCGTAGGTGAACCTGCGGAAGGATCATTACGAAGTCATCCATCGCAAGTT
GGGTGCTGGTCTACCACGGGGTATTCCAATCCGTGTCTATCTACTCTTGTTGCTTTGGCAGGCCGTGGTC
TTCCACTGTAAGCTTCGGCCTACACGTGCTTGCCAGAGGACCAAACTCTGAATTTTTAGTGATGTCTGAG
TACTATGTAATAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAA
TGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTGTGG
TATTCCGCAGGGCATGCCTGTTCGAGCGTCATTATAGCCACTCAAGCCTGGCTTGGTGTTGGGGCATGCC
GTCTGGCAGTCTCTAAAATCAGTGGCGGTAACCGGTAGGCTCTGAGCGTAGTAAATCTCCTCGCTATAGA
GTCCTATCTGTCCCCTGCCAAAACCCCCATATCTTTTATAGGTGACCTCGAT

Image

Caption
Image Tnsf 17758x2 ph1259 dm0031 640
Image Tnsf17758f

Map


Back