英語 [English] / 日本語 [Japanese]

MolliBase: Details of Record

Back


TNS:F:17771

Detail

Catalog number17771
Scientific nameMollisia sp.
GenusMollisia
Specific epithet
Infraspecific epithet
Taxon rank
Scientific name authorship
CountryJapan
LocalityMikuniyama, Yozuku, Ashigarakami-gun, Kanagawa Pref.
Habitaton unidentified branch
Minimum elevation in meters780.0
Decimal latitude35.42503
Decimal longitude138.97411
Year2005
Month7
Day2
Isolate IDFC-1184
Other isolate ID
Isolate statussingle
DNA sample IDED20109
NoteMLZ+ with KOH pretreatment; KOH reaction positive.

Sequence

Sequence ID4554
Region name
INSD Accession No. (DDBJ/NCBI/EMBL)
BOLD Accession No.
Sequence
>T_17771S4554
ATCCTCCCGTAGGGGGAACCTGCGGAAGGATCATTACAAGTGAGCCCGGTGACCGTTGGCAACAGCGCTC
TCTCGGGCATCGCCCACCCGTGTCTACATACTCTTGTTGCTTTGGCAGGCCGTGGCTTCCACCGCGGGAC
AAGTTCGCGAGTGCTTGCCAAGGGACCAAACTCTGAATATTAGTGATGTCTGAGTACTATATAATAGTTA
AAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTG
AATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTGTGGTATTCCGCAGGGCATG
CCTGTTCGAGCGTCATTACAACCAATCACGCCTGGCGTGGTGTTGGGGCACGCGGCTCTGCGGCCCTCAA
AATCAGTGGCGGCGCCAGACGGCTCTAAGCGTAGTAAATCTCCTCGCTATAGGGACCGGTTGGTGGCTCG
CCAGAACCCCCACTTCTCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATA
AGCGGA

Image

Caption
Image Tnsf 17771x2 ph1253 dm0015 640
Image Tnsf17771f

Map


Back