英語 [English] / 日本語 [Japanese]

MolliBase: Details of Record

Back


TNS:F:17775

Detail

Catalog number17775
Scientific nameMollisia sp.
GenusMollisia
Specific epithet
Infraspecific epithet
Taxon rank
Scientific name authorship
CountryJapan
LocalityIdenzawa, Nakagawa, Yamakitacho, Ashigarakami-gun, Kanagawa Pref.
Habitaton unidentied wood
Minimum elevation in meters824.0
Decimal latitude35.45519
Decimal longitude138.99702
Year2005
Month7
Day3
Isolate IDFC-1187
Other isolate ID
Isolate statussingle
DNA sample IDED20110
NoteMLZ+ with or without KOH pretreatment; KOH reaction positive.

Sequence

Sequence ID4555
Region name
INSD Accession No. (DDBJ/NCBI/EMBL)
BOLD Accession No.
Sequence
>T_17775S4555
CCTTCCGTAGGGGGAACCTGCGGAAGGATCATTACAAGTGAGCCCGGTGACCGTTGGCAACAGCGCTCTC
TCGGGCATCGCCCACCCGTGTCTACATACTCTTGTTGCTTTGGCAGGCCGTGGCTTCCACCGCGGGACAA
GTTCGCGAGTGCTTGCCAAGGGACCAAACTCTGAATATTAGTGATGTCTGAGTACTATATAATAGTTAAA
ACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAA
TTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTGTGGTATTCCGCAGGGCATGCC
TGTTCGAGCGTCATTACAACCAATCACGCCTGGCGTGGTGTTGGGGCACGCGGCTCTGCGGCCCTCAAAA
TCAGTGGCGGCGCCAGACGGCTCTAAGCGTAGTAAATCTCCTCGCTATAGGGACCGGTTGGTGGCTCGCC
AGAACCCCCACTTCTCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATA

Image

Caption
Image Tnsf 17775x2 ph1267 dm0022 640
Image Tnsf 17775x2 ph1267 dm0023 640
Image Tnsf17775f

Map


Back