英語 [English] / 日本語 [Japanese]

MolliBase: Details of Record

Back


TNS:F:17829

Detail

Catalog number17829
Scientific nameMollisia sp.
GenusMollisia
Specific epithet
Infraspecific epithet
Taxon rank
Scientific name authorship
CountryJapan
LocalitySugadaira Montane Research Center, University of Tsukuba, Ueda City, Nagano Pref.
Habitaton unidentified branch
Minimum elevation in meters1269.0
Decimal latitude36.51933
Decimal longitude138.35305
Year2005
Month9
Day16
Isolate IDFC-1195
Other isolate ID
Isolate statussingle
DNA sample IDED20111
NoteMLZ+ with KOH pretreatment; KOH reaction negative.

Sequence

Sequence ID4557
Region name
INSD Accession No. (DDBJ/NCBI/EMBL)
BOLD Accession No.
Sequence
>T_17829S4557
AACCTGCGGAAGGATCATTAATCAGTGGATCCGGCGGGGACCTCCCCGCCGGGTAGACCTCCACCCGTGC
CTATCTACTCTTGTTGCTTTGGCGGGCCGTGGCCTCCACTACGGGCTCTGCTCGTACGTGCCCGCCAGAG
GACCAAACTCTGAATTTTAGTGATGTCTGAGTACTATTTAATAGTTAAAACTTTCAACAACGGATCTCTT
GGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCAT
CGAATCTTTGAACGCACATTGCGCCCTGTGGTATTCCGCAGGGCATGCCTGTTCGAGCGTCATTTAGACC
ACTCACGCCTGGCGTGGTATTGGGGCACGCGGTTCCGCGGCCCTCAAAATCAGTGGCGGCGCCGGTAGGC
CCTAAGCGTAGTAAATCTCCTCGCTATAGGGTCCTCTCGGTGGCTCGCCAGAACCCCCCAACTTCTCAAG
GTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAA

Image

Caption
Image Tnsf 17829x2 ph1259 dm0036 640
Image Tnsf17829f

Map


Back