英語 [English] / 日本語 [Japanese]

MolliBase: Details of Record

Back


TNS:F:17837

Detail

Catalog number17837
Scientific nameMollisia sp.
GenusMollisia
Specific epithet
Infraspecific epithet
Taxon rank
Scientific name authorship
CountryJapan
LocalitySugadaira Montane Research Center, University of Tsukuba, Ueda City, Nagano Pref.
Habitaton Miscanthus sinensis stem
Minimum elevation in meters1326.0
Decimal latitude36.52197
Decimal longitude138.34936
Year2005
Month9
Day17
Isolate IDFC-1199
Other isolate ID
Isolate statussingle
DNA sample IDED20112
NoteMLZ+ with or without KOH pretreatment; KOH reaction negative.

Sequence

Sequence ID4558
Region name
INSD Accession No. (DDBJ/NCBI/EMBL)
BOLD Accession No.
Sequence
>T_17837S4558
ATCCTTCCCGTAAGGGGACCTGCGGAAGGATCATTACAAAAAGGTCGCCGGTGTTTCCTAGGCAATGTCT
TGCGTTTCGCTCGACCGTTGGGTGGCTGTCTTAAACTCACAGCACTGCCAGTTGCCTATACCTACCGATG
CTGTAGCTGAAAGATTGCTACAGGCCGAGCGAATCCCACCCGTGTCTACATACTCTTGTTGCTTTGGCGG
GTCGTGGCCTCCACTGTGGGCTCTGCCTGCATGTGCCCGCCAGAGGATCAAACTCTGAATTTTAGTGATG
TCTGAGTACTATATAATAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCA
GCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCC
CTGTGGTATTCCGCAGGGCATGCCTGTTCGAGCGTCATTACAACCACTCAAGCCTGGCTTGGTCTTGGGG
TTTGCGGTTCCGCAGCCCCTAAAATCAGTGGCGGTGCCGGTGTGGCTCTACGCGTAGTAATTCTTCTCGC
GATGGAGTTCCCCTGGAGACCTGCCAGAACCCCCCATTTTTTTTACAGGTTGACCTCGGATCAGGTAGGG
ATACCCGCTGAACTTAAGCATATCAATAA

Image

Caption
Image Tnsf 17837x2 ph1268 dm0002 640
Image Tnsf17837f

Map


Back