英語 [English] / 日本語 [Japanese]

MolliBase: Details of Record

Back


TNS:F:17857

Detail

Catalog number17857
Scientific nameMollisia sp.
GenusMollisia
Specific epithet
Infraspecific epithet
Taxon rank
Scientific name authorship
CountryJapan
LocalityMinakami-machi, Gunma Pref.
Habitaton unidentified branch
Minimum elevation in meters613.0
Decimal latitude36.81294
Decimal longitude139.03472
Year2005
Month9
Day18
Isolate IDFC-1211
Other isolate ID
Isolate statussingle
DNA sample IDED20113
NoteMLZ+ with KOH pretreatment; KOH reaction negative.

Sequence

Sequence ID4560
Region name
INSD Accession No. (DDBJ/NCBI/EMBL)
BOLD Accession No.
Sequence
>T_17857S4560
ATCCTTCCGGTAGGGGGACCTGCGGAAGGATCATTAATCAGTGGATCCGGCGGGGACCTCCCCGCCGGGT
AGACCTCCACCCGTGCCTATCTACTCTTGTTGCTTTGGCGGGCCGTGGCCTCCACTACGGGCTCTGCTCG
TACGTGCCCGCCAGAGGACCAAACTCTGGATTTTAGTGATGTCTGAGTACTATTTAATAGTTAAAACTTT
CAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCA
GAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTGTGGTATTCCGCAGGGCATGCCTGTTC
GAGCGTCATTTAGACCACTCACGCCTGGCGTGGTATTGGGGCACGCGGTTCCGCGGCCCTCAAAATCAGT
GGCGGCGCCGGTAGGCCCTAAGCGTAGTAAATCTCCTCGCTATAGGGTCCTCTCGGTGGCTCGCCAGAAC
CCCCCAACTTCTCAAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCG
GAGGAA

Image

Caption
Image Tnsf 17857x2 ph1259 dm0050 640
Image Tnsf 17857x2 ph1259 dm0052 640
Image Tnsf17857f

Map


Back