英語 [English] / 日本語 [Japanese]

MolliBase: Details of Record

Back


TNS:F:17866

Detail

Catalog number17866
Scientific nameMollisia sp.
GenusMollisia
Specific epithet
Infraspecific epithet
Taxon rank
Scientific name authorship
CountryJapan
LocalityMt. Kurodake, Kuju-machi, Takeda-shi, Oita Pref.
Habitaton unidentified branch
Minimum elevation in meters882.0
Decimal latitude33.12405
Decimal longitude131.29419
Year2005
Month10
Day9
Isolate IDFC-1216
Other isolate ID
Isolate statussingle
DNA sample IDED20114
NoteMLZ+ with KOH pretreatment; MLZ- without KOH pretreatment; KOH reaction negative.

Sequence

Sequence ID4563
Region name
INSD Accession No. (DDBJ/NCBI/EMBL)
BOLD Accession No.
Sequence
>T_17866S4563
ATCCTTCCGTAAGGGGAACCTGCGGAAGGATCATTAACAAACCTAAGGCGCTCGCGCTCACAGGTAACCC
TTGAATAAACTACCTTCGTTGCTTTGGCGGGCCGCCTCTCGAGGCCAGCGGCTTCGGCTGCTGCGCGCCC
GCCAGAGGACCACAACTCTTGTTTTCAGTGATGTCTGAGTACTATATAATAGTTAAAACTTTCAACAACG
GATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAG
TGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTCGAGCGTCA
TTATAACCACTCAAGCCTTCGCTTGGTATTGGGGCTCGCGGTCGCGCGGCCCCTAAAATCAGTGGCGGTG
CCGGCTGGCTCTACGCGTAGTAATACTCCTCGCGTCTGGGTCCGGTCGGTTGCCTGCCAGCAACCCCCCA
TTTTTACAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCCGGAGGAA

Image

Caption
Image Tnsf 17866x2 ph1259 dm0054 640
Image Tnsf17866f

Map


Back