英語 [English] / 日本語 [Japanese]

MolliBase: Details of Record

Back


TNS:F:17910

Detail

Catalog number17910
Scientific nameMollisia sp.
GenusMollisia
Specific epithet
Infraspecific epithet
Taxon rank
Scientific name authorship
CountryJapan
LocalityKikuchi valley, Kikuchi-shi, Kumamoto Pref.
Habitaton unidentied wood
Minimum elevation in meters612.0
Decimal latitude33.00783
Decimal longitude130.94063
Year2005
Month10
Day10
Isolate IDFC-1234
Other isolate ID
Isolate statussingle
DNA sample IDED20115
NoteMLZ+ with KOH pretreatment; MLZ- without KOH pretreatment; KOH reaction negative.

Sequence

Sequence ID4564
Region name
INSD Accession No. (DDBJ/NCBI/EMBL)
BOLD Accession No.
Sequence
>T_17910S4564
CGGCGGGGGACTCTCCGGAGGATCCCCGTCGGGTAGACCTCCACCCGTGCTTACCTACTCTTGTTGCTTT
GGCGGGACGTGGCCTCCACTACGGGCTCTGCTCGTACGTGCCCGCCAGAGGACCAAACTCTGAATATTAG
TGATGTCTGAGAACTATTTAATAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGA
ACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATT
GCGCCCTGTGGTATTCTGCAGGGCATGCCTGTTCGAGCGTCATTTAGACCACTCACGCCTAGCGTGGTAT
TGGGGCACGTGGTTTCGCGGCCCTCAAAATCAGTGGCGGTGCCGGTAGGCCCTAAGCGTAGTAAATCTCC
TCGCTATAGGGTCCTCTCGGTGGCTCGCCAGAACCCCCAACTTCTTAAGGTTGACCTCGGATCAGGTAGG
GATACCCGCTGAACTTAAGCATATCAAA

Image

Caption
Image Tnsf 17910x2 ph1259 dm0063 640
Image Tnsf17910f

Map


Back