英語 [English] / 日本語 [Japanese]

MolliBase: Details of Record

Back


TNS:F:17993

Detail

Catalog number17993
Scientific nameMollisia sp.
GenusMollisia
Specific epithet
Infraspecific epithet
Taxon rank
Scientific name authorship
CountryJapan
LocalityYuzawa-machi, Minamiuwonuma-shi, Niigata Pref.
Habitaton broad leaved tree branch
Minimum elevation in meters919.0
Decimal latitude36.8253
Decimal longitude138.78133
Year2006
Month5
Day12
Isolate IDFC-1329
Other isolate ID
Isolate statussingle
DNA sample IDED20121
NoteMLZ+ with or without KOH pretreatment; KOH reaction negative.

Sequence

Sequence ID4576
Region name
INSD Accession No. (DDBJ/NCBI/EMBL)
BOLD Accession No.
Sequence
>T_17993S4576
ATTCTTCCGTAGGTGAACCTGCGGAAGGATCATTAAAAAGATCAACCCGGTTGTGAAGTCAATGCCTTAC
CGGCCTTGTGGGGCTGTCTTAAACTCACAGCAATGCCAATTGACAAGTCATGCCTGTTTACAGGCCTTGT
GGGGCTGTTTTAAACTCACAGCAATACCAGTGACGCACACTCATACCGGGGGCTTCGGCCCCCGGGCCGG
TTGAATCCCACCCGTGTCTACATACTCTTGTTGCTTTGGCAGGCCGTGGTCTCCACTGTGGGCTCTGCCT
GCATGTGCCTGCCAGAGGACCAAACTCTGAATTTTAGTGATGTCTGAGTACTATATAATAGTTAAAACTT
TCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGC
AGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTGTGGTATTCCGCAGGGCATGCCTGTT
CGAGCGTCATTATAACCACTCAAGCCTGGCTTGGTATTGGAGGTTGCGGTTCCGCAGCTCCTAAAATCAG
TGGCGGTGCCGGTGTGGCTCTACGCGTAGTAATTCTTCTCGCGATGGAGTTCCCCTGGTTGCTTGCCAAA
ACCCCCCAATTTATACAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAG
CGGGAGGA

Image

Caption
Image Tnsf 17993x2 ph1259 dm0074 640
Image Tnsf 17993x2 ph1259 dm0075 640
Image Tnsf17993f

Map


Back