英語 [English] / 日本語 [Japanese]

MolliBase: Details of Record

Back


TNS:F:17994

Detail

Catalog number17994
Scientific nameMollisia sp.
GenusMollisia
Specific epithet
Infraspecific epithet
Taxon rank
Scientific name authorship
CountryJapan
LocalityMinakami-machi, Gunma Pref.
Habitaton Alnus branch
Minimum elevation in meters1006.0
Decimal latitude36.74558
Decimal longitude138.83358
Year2006
Month5
Day12
Isolate IDFC-1330
Other isolate ID
Isolate statussingle
DNA sample IDED20122
NoteMLZ+ with or without KOH pretreatment; KOH reaction negative.

Sequence

Sequence ID4577
Region name
INSD Accession No. (DDBJ/NCBI/EMBL)
BOLD Accession No.
Sequence
>T_17994S4577
ATCCTTCCGTAGGGGAACCTGCGGAAGGATCATTACCCAAAAGGATACTTCGGTATACCCAACCCGTGTC
TATCTACTCTTGTTGCTTTGGCAGGCTGTGGTTAATCCACTGCGGGCTCTTGCCTGTACATTCGTCTGCC
AGAGGACCAAACTCTGAATTTTAGTGATGTCTGAGTACTATATAATAGTTAAAACTTTCAACAACGGATC
TCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAA
TCATCGAATCTTTGAACGCACATTGCGCCCTGTGGTATTCCGCAGGGCATGCCTGTTCGAGCGTCATTAT
AGCCAATTAAGCCTAGCTTAGTATTGGGGCTCGCGGTCTCGCGGCCTCTAAAACCAGTGGCGGTGCCGGT
AGGCTCTGAGCGTAGTAATACTCCTCGCTATAGAGTCCTGTCGGTTCCCTGCCAGAACCCCCATATTTTA
TCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAA

Image

Caption
Image Tnsf 17994x2 ph1259 dm0078 640
Image Tnsf 17994x2 ph1259 dm0079 640
Image Tnsf17994f

Map


Back