英語 [English] / 日本語 [Japanese]

MolliBase: Details of Record

Back


TNS:F:17996

Detail

Catalog number17996
Scientific namePyrenopeziza nervicola
GenusPyrenopeziza
Specific epithetnervicola
Infraspecific epithet
Taxon rank
Scientific name authorship
CountryJapan
LocalityMinakami-machi, Gunma Pref.
Habitaton Fagus crenata cupule
Minimum elevation in meters1006.0
Decimal latitude36.74558
Decimal longitude138.83358
Year2006
Month5
Day12
Isolate IDFC-1332
Other isolate ID
Isolate statussingle
DNA sample IDED20123
NoteMLZ+ with or without KOH pretreatment; KOH reaction negative.

Sequence

Sequence ID4578
Region name
INSD Accession No. (DDBJ/NCBI/EMBL)
BOLD Accession No.
Sequence
>T_17996S4578
ATCCTTCCGTAGGTGAACCTGCGGAAGGATCATTATCAAGGTTAAAGGTGCGCTCCGGCGTAAACCGAAC
CCGTGTCTATCTACTCTTGTTGCTTTGGCAGGCCGTGGGCAACCACCGCGGGCTCCGGCCTTCGAGCGCC
TGCCAGAGGACCAAACTCTGAATTTTAGTGATGTCTGAGTACTATACAATAGTTAAAACTTTCAACAACG
GATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAG
TGAATCATCGAATCTTTGAACGCACATTGCGCCCGGTGGTATTCCGCCGGGCATGCCTGTTCGAGCGTCA
TTATAACCACTCAAGCCTGGCTTGGTATTGGGACCTGCTGCTACCGGCAGTCCCTAAAACTAGTGGCGGT
GCCCGTAGGCTCTGAGCGTAGTAATACTCCTCGCTATAGAGTCCTGCGGGTTCCCTGCCAAAACCCCCAA
ATTTTACAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAA

Image

Caption
Image Tnsf 17996x2 ph1276 dm0006 640
Image Tnsf17996f

Map


Back