英語 [English] / 日本語 [Japanese]

MolliBase: Details of Record

Back


TNS:F:18013

Detail

Catalog number18013
Scientific nameMollisia sp.
GenusMollisia
Specific epithet
Infraspecific epithet
Taxon rank
Scientific name authorship
CountryJapan
LocalityUchikawame, Oh-hazama-machi, Iwate Pref.
Habitaton unidentified wood
Minimum elevation in meters321.0
Decimal latitude39.54427
Decimal longitude141.3305
Year2006
Month5
Day23
Isolate IDFC-1339
Other isolate ID
Isolate statussingle
DNA sample IDED20124
NoteMLZ+ with or without KOH pretreatment; KOH reaction negative.

Sequence

Sequence ID4579
Region name
INSD Accession No. (DDBJ/NCBI/EMBL)
BOLD Accession No.
Sequence
>T_18013S4579
CCTTCCGTAGGTGAACCTGCGGAAGGATCATTACCCAAAAGGATACTTCGGTATACCCAACCCGTGTCTA
TCTACTCTTGTTGCTTTGGCAGGCTGTGGTTAATCCACTGCGGGCTCTTGCCTGTACATTCGTCTGCCAG
AGGACCAAACTCTGAATTTTAGTGATGTCTGAGTACTATATAATAGTTAAAACTTTCAACAACGGATCTC
TTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATC
ATCGAATCTTTGAACGCACATTGCGCCCTGTGGTATTCCGCAGGGCATGCCTGTTCGAGCGTCATTATAG
CCAATTAAGCCTAGCTTAGTATTGGGGCTCGCGGTCTCGCGGCCTCTAAAACCAGTGGCGGTGCCGGTAG
GCTCTGAGCGTAGTAATACTCCTCGCTATAGAGTCCTGTCGGTTCCCTGCCAGAACCCCCATATTTTATC
AGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGA

Image

Caption
Image Tnsf 18013x2 ph1268 dm0005 640
Image Tnsf18013f

Map


Back