英語 [English] / 日本語 [Japanese]

MolliBase: Details of Record

Back


TNS:F:18018

Detail

Catalog number18018
Scientific nameMollisia sp.
GenusMollisia
Specific epithet
Infraspecific epithet
Taxon rank
Scientific name authorship
CountryJapan
LocalityUchikawame, Oh-hazama-machi, Iwate Pref.
Habitaton Aconitum stem
Minimum elevation in meters321.0
Decimal latitude39.54427
Decimal longitude141.3305
Year2006
Month5
Day23
Isolate IDFC-1344
Other isolate ID
Isolate statussingle
DNA sample IDED20125
NoteMLZ+ with or without KOH pretreatment; KOH reaction negative.

Sequence

Sequence ID4580
Region name
INSD Accession No. (DDBJ/NCBI/EMBL)
BOLD Accession No.
Sequence
>T_18018S4580
CCTGCGGAAGGATCATTACTAGAGCAAAGAACAGACAGCGCCCCATAGGAGCTTGCTCCGTGGCGGGCTA
CCCTACTCGTAGGGTCTAGAGTCGTAGGGCCTCTCGGAGAAGCCCTGTTCTGAACTCCACCCTTGAATAA
ATTACCTTTGTTGCTTTGGCAGGCCGCCTAGTGCCAGCGGCTTCGGCTGTTGAGTGCCTGCCAGAGACCT
ATAACTCGTATTGTTAATGATGTCTGAGTACTATATAATAGTTAAAACTTTCAACAACGGATCTCTTGGT
TCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGA
ATCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTATAACCACT
CAAGCTCTCGCTTGGTATTGGGGTTCGCGGTTTCGCGGCCCCTAAAATCAGTGGCGGTGCCTGTCGGCTC
TACGCGTAGTAATACTCCTCGCGATTGAGTCCGGTAGGTCTACTTGCCAGCAACCCCCAATTTTTACAGG
TTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAAA

Image

Caption
Image Tnsf 18018x2 ph1276 dm0009 640
Image Tnsf18018f

Map


Back