英語 [English] / 日本語 [Japanese]

MolliBase: Details of Record

Back


TNS:F:18021

Detail

Catalog number18021
Scientific namePyrenopeziza nervicola
GenusPyrenopeziza
Specific epithetnervicola
Infraspecific epithet
Taxon rank
Scientific name authorship
CountryJapan
LocalitySeishu rindo, Shiragami, Aomori Pref.
Habitaton Fagus crenata leaf
Minimum elevation in meters260.0
Decimal latitude40.5045
Decimal longitude140.20233
Year2006
Month5
Day24
Isolate IDFC-1349
Other isolate ID
Isolate statussingle
DNA sample IDED20127
NoteMLZ+ with or without KOH pretreatment; KOH reaction negative.

Sequence

Sequence ID4582
Region name
INSD Accession No. (DDBJ/NCBI/EMBL)
BOLD Accession No.
Sequence
>T_18021S4582
ATCCTTCCGTAGGGGGAACCTGCGGAAGGATCATTATCAAGGTTAAAGGTGCGCTCCGGCGTAAACCGAA
CCCGTGTCTATCTACTCTTGTTGCTTTGGCAGGCCGTGGGCAACCACCGCGGGCTCCGGCCTTCGAGCGC
CTGCCAGAGGACCAAACTCTGAATTTTAGTGATGTCTGAGTACTATATAATAGTTAAAACTTTCAACAAC
GGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCA
GTGAATCATCGAATCTTTGAACGCACATTGCGCCCGGTGGTATTCCGCCGGGCATGCCTGTTCGAGCGTC
ATTATAACCACTCAAGCCTGGCTTGGTATTGGGACCTGCTGCTACCGGCAGTCCCTAAAACTAGTGGCGG
TGCCCGTAGGCTCTGAGCGTAGTAATACTCCTCGCTATAGAGTCCTGCGGGTTCCCTGCCAGAACCCCCA
AATTTTTACAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAA

Image

Caption
Image Tnsf 18021x4 ph1259 dm0099 640
Image Tnsf18021f

Map


Back