英語 [English] / 日本語 [Japanese]

MolliBase: Details of Record

Back


TNS:F:18023

Detail

Catalog number18023
Scientific nameBelonopsis sp.
GenusBelonopsis
Specific epithet
Infraspecific epithet
Taxon rank
Scientific name authorship
CountryJapan
LocalitySeishu rindo, Shiragami, Aomori Pref.
Habitaton bamboo stem
Minimum elevation in meters260.0
Decimal latitude40.5045
Decimal longitude140.20233
Year2006
Month5
Day24
Isolate IDFC-1351
Other isolate ID
Isolate statussingle
DNA sample IDED20128
NoteMLZ+ with or without KOH pretreatment; KOH reaction negative.

Sequence

Sequence ID4583
Region name
INSD Accession No. (DDBJ/NCBI/EMBL)
BOLD Accession No.
Sequence
>T_18023S4583
TCCTTCCGTAGGGGAACCTGCGGAAGGATCATTAAATAAGGATACCTCTTCGGTATACCCCATCCGTGTC
TACTTACCTTTGTTGCTTTGGCAGGCCGTGAGTTTTACTCCTGTGGGTTCGCCTGCATGTGCCTGCCAAG
GGTCCAAACTCTGATTTTAGTGGTGTCTGAGTACTATATAATAGTTAAAACTTTCAACAACGGATCTCTT
GGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCAT
CGAATCTTTGAACGCACATTGCGCCCAGCGGTATTCCGCCGGGCATGCCTGTTCGAGCGTCTCTATCAAC
CATCACGCCCCGGCGTGGAATTGGGGACTACGGTTTCGGCTGTAGCCTTAAATATCATAAGCGATACTTT
CCGGGTTCTAAGCGTAGTACATACCCCGCTACAGGACTTGGTTGGACTTCTGCTGTAAATGGTGCAAGCC
CTCTCTTAAGGTTGACCTCGAATCAAGCAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGAGA
A

Image

Caption
Image Tnsf 18023x2 ph1265 dm0004 640
Image Tnsf18023f

Map


Back