英語 [English] / 日本語 [Japanese]

MolliBase: Details of Record

Back


TNS:F:18072

Detail

Catalog number18072
Scientific namePyrenopeziza sp.
GenusPyrenopeziza
Specific epithet
Infraspecific epithet
Taxon rank
Scientific name authorship
CountryJapan
LocalityAratojoseki, Yuzawa-machi, Niigata Pref.
Habitaton Fallopia sachalinensis stem
Minimum elevation in meters730.0
Decimal latitude36.91005
Decimal longitude138.79297
Year2006
Month6
Day18
Isolate IDFC-1401
Other isolate ID
Isolate statussingle
DNA sample IDED20134
NoteMLZ+ with or without KOH pretreatment; KOH reaction negative.

Sequence

Sequence ID4700
Region name
INSD Accession No. (DDBJ/NCBI/EMBL)
BOLD Accession No.
Sequence
>T_18072S4700
CTTCCGTAGGTGAACCTGCGGAAGGATCATTACTAGAGCAAAGGACAGACAGCGCCCCACAGGAGCTTGC
TCCGTGGCGGGCTACCCTTTAGCGGTGTAAGCCGCGGGGGTTTAGAGTCGTCGAACCTCTCGGAGAAGTT
CGGTCCCAAACTCCACCCTTGAATAAATTACCTTTGTTGCTTTGGCAGGCCGCCTCGTGCCAGCGGCTTC
GGCTGTTGAGTGCCTGCCAGAGGACCACAACTCTTGTTTTTAGTGATGTCTGAGTACTATATAATAGTTA
AAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTG
AATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGGGGGCATG
CCTGTTCGAGCGTCATTATAACCACTCAAGCTCTCGCTTGGTATTGGGGTTCGCGGTTTCGCGGCCCCTA
AAATCAGTGGCGGTGCCTGTCGGCTCTACGTGTAGTAATACTCCTCGCGATTGAGTCCGGTAGGTTTACT
TGCCAGCAACCCCCAATTTTTACAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATAT
CAATA

Image

Caption
Image Tnsf 18072x2 ph1268 dm0009 640
Image Tnsf18072f

Map


Back