英語 [English] / 日本語 [Japanese]

MolliBase: Details of Record

Back


TNS:F:25567

Detail

Catalog number25567
Scientific namePyrenopeziza sp.
GenusPyrenopeziza
Specific epithet
Infraspecific epithet
Taxon rank
Scientific name authorship
CountryJapan
LocalityKuni-mura, Agatsuma-gun, Gunma Pref.
Habitaton bamboo column
Minimum elevation in meters1564.0
Decimal latitude36.64588
Decimal longitude138.57591
Year2009
Month5
Day19
Isolate IDFC-1878
Other isolate ID
Isolate statussingle
DNA sample IDED20135
NoteMLZ+ with or without KOH pretreatment; KOH reaction negative.

Sequence

Sequence ID4716
Region name
INSD Accession No. (DDBJ/NCBI/EMBL)
BOLD Accession No.
Sequence
>T_25567S4716
TTCCGTAGGGGAACCTGCGGAAGGATCATTAAATAAGGATGCCTTTATGGTATACCCCATCCGTGTCTAC
ATACTCTTGTTGCTTTGGCAGGCCGTGGTTCTTACCCTGTGGGCTTCTGCCTGCATGCGCCTGCCAGAGG
ACCAAACTCTGAATTTTAGTGATGTCTGAGTACTATATAATAGTTAAAACTTTCAACAACGGATCTCTTG
GTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATC
GAATCTTTGAACGCACATTGCGCCCAGTGGTATTCCGCCGGGCATGCCTGTTCGAGCGTCTCTATCAGCC
ATCACGTCTCGGCGTGGAATTGGGGACTGTGGTGTTCTGCTGCAGCCCTAAATCTCATAAGCGATATCAG
TTGGTTCTAAGCGTAGTAATATACCCCGCTACAGGACTTAGCTGGTCTTCTGCTGTAAATGGTGCAAGCC
CATACTTAAGGTTGACCTCGAATCAAGTAGGGATACCCGCTGAACTTAAGCATATCAATAA

Image

Caption
Image Tnsf 25567x2 ph1268 dm0012 640
Image Tnsf25567f

Map


Back